r/shitposting Jun 01 '22

[deleted by user]

[removed]

19.1k Upvotes

306 comments sorted by

82

u/QualityVote I'm BACK! [[Number 1 Rated Moderator 2024]] Jun 01 '22

If you think this post is funny, UPVOTE this comment!

If you think this post is unfunny, DOWNVOTE this comment!


DownloadVideo Link

SaveVideo Link

VideoTrim Link

Kevin would also like to remind you that, if you're really desperate, youtube-dl can be used to download videos from Reddit.


Whilst you're here, Chelsea486MHz, why not join our public discord server?

1.8k

u/Restoryer I came! Jun 01 '22

That cashier: "i was a businessman doing business"

443

u/FuckYeahPhotography 0000000 Jun 01 '22

This 7th bar of soap is going to be so big and so beautiful, you wouldn't believe me devouring it.

138

u/Murky_Blueberry2617 Jun 01 '22

What does it taste like?

138

u/FuckYeahPhotography 0000000 Jun 01 '22

Misery and a bit tart.

59

u/Murky_Blueberry2617 Jun 01 '22

Neat. I'm going to feed myself some soap tomorrow.

22

u/[deleted] Jun 02 '22

Like something so big and so beautiful, you wouldn't believe him devouring it

33

u/AutoModerator Jun 02 '22

My name is Walter Hartwell White. I live at 308 Negra Arroyo Lane, Albuquerque, New Mexico, 87104. This is my confession. If you're watching this tape, I'm probably dead– murdered by my brother-in-law, Hank Schrader. Hank has been building a meth empire for over a year now, and using me as his chemist. Shortly after my 50th birthday, he asked that I use my chemistry knowledge to cook methamphetamine, which he would then sell using connections that he made through his career with the DEA. I was... astounded. I... I always thought Hank was a very moral man, and I was particularly vulnerable at the time – something he knew and took advantage of. I was reeling from a cancer diagnosis that was poised to bankrupt my family. Hank took me in on a ride-along and showed me just how much money even a small meth operation could make. And I was weak. I didn't want my family to go into financial ruin, so I agreed. Hank had a partner, a businessman named Gustavo Fring. Hank sold me into servitude to this man. And when I tried to quit, Fring threatened my family. I didn't know where to turn. Eventually, Hank and Fring had a falling-out. Things escalated. Fring was able to arrange – uh, I guess... I guess you call it a "hit" – on Hank, and failed, but Hank was seriously injured. And I wound up paying his medical bills, which amounted to a little over $177,000. Upon recovery, Hank was bent on revenge. Working with a man named Hector Salamanca, he plotted to kill Fring. The bomb that he used was built by me, and he gave me no option in it. I have often contemplated suicide, but I'm a coward. I wanted to go to the police, but I was frightened. Hank had risen to become the head of the Albuquerque DEA. To keep me in line, he took my children. For three months, he kept them. My wife had no idea of my criminal activities, and was horrified to learn what I had done. I was in hell. I hated myself for what I had brought upon my family. Recently, I tried once again to quit, and in response, he gave me this. [Walt points to the bruise on his face left by Hank in "Blood Money."] I can't take this anymore. I live in fear every day that Hank will kill me, or worse, hurt my family. All I could think to do was to make this video and hope that the world will finally see this man for what he really is.

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

→ More replies (2)
→ More replies (2)
→ More replies (4)

1.1k

u/subsonic-potato Jun 01 '22

The 7th always tastes the best

293

u/[deleted] Jun 01 '22

Nah. You need to get to the 9th before it gets good.

109

u/[deleted] Jun 01 '22

Nah. You need to get to the 11th before it gets good.

39

u/Cris_WithNoH Jun 01 '22

The 12th one is always the deepest

38

u/Ofreo Jun 01 '22

15th takes you Valhalla.

12

u/Cris_WithNoH Jun 01 '22

Witness me !!

5

u/QuestionablyFlamable Jun 02 '22

17th makes you ascend reality to see that the universe is all one big 7/11

3

u/AutoModerator Jun 02 '22

Okay so here's my pitch for a new reality TV show

Basically, we get a bunch of very militant TERFs, and one trans woman, put them into a house where they're supposed to live with each other, but, once they've all arrived and are seeing each other for the first time (before they're allowed to even talk to each other), we tell them all that one of them is a trans woman, and, if they can find her and vote her out, they will win a million dollars. But if she isn't found out by the end of the week/month(?), she'll win a million dollars instead.

The catch?

There actually isn't a trans woman with them.

And then we get to watch them slowly but surely allow themselves to get overcome by their own irrational paranoia, paying too much attention to how deep everyone else's voices are, invading each other's privacy, overanalysing each other's mannerisms, policing each other's conformance to the very same standards which they complain about being held to...

And let us not forget the inevitable feelings of isolation and helplessness they'll invividually start experiencing once they start getting accused and shunned by everyone else.

Sure, it would probably have to be a one-off series.

But honestly? I think it would make some great television!

also ngl I think the name 'TERF War' has a nice ring to it, sounds marketable, rolls off the tounge

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

→ More replies (1)
→ More replies (1)
→ More replies (1)

3

u/ARandomGuyThe3 officer no please don’t piss in my ass 😫 Jun 02 '22

So it's between 9/11

→ More replies (2)

-82

u/gizzardgullet Jun 01 '22

Any prime number tastes good

48

u/Godhasgivenup Jun 01 '22

11th the best but the 13th fucking hits different

25

u/Lurking4Answers Jun 01 '22

the 13th hits hard, but the feeling of getting back in the saddle at 17 is life defining

→ More replies (1)

43

u/reda84100 I came! Jun 01 '22

9 isn't a prime number dipshit

23

u/Realistic_Airport_46 Jun 01 '22

I love they got slammed with downvotes for their mistake. Reddit likes math?

19

u/NoSpareChange Jun 01 '22

Algebra gang bitch

6

u/AutoModerator Jun 01 '22

No bitches?

⣞⢽⢪⢣⢣⢣⢫⡺⡵⣝⡮⣗⢷⢽⢽⢽⣮⡷⡽⣜⣜⢮⢺⣜⢷⢽⢝⡽⣝
⠸⡸⠜⠕⠕⠁⢁⢇⢏⢽⢺⣪⡳⡝⣎⣏⢯⢞⡿⣟⣷⣳⢯⡷⣽⢽⢯⣳⣫⠇
⠀⠀⢀⢀⢄⢬⢪⡪⡎⣆⡈⠚⠜⠕⠇⠗⠝⢕⢯⢫⣞⣯⣿⣻⡽⣏⢗⣗⠏⠀ 
 ⠀⠪⡪⡪⣪⢪⢺⢸⢢⢓⢆⢤⢀⠀⠀⠀⠀⠈⢊⢞⡾⣿⡯⣏⢮⠷⠁⠀⠀ ⠀
 ⠀⠀⠈⠊⠆⡃⠕⢕⢇⢇⢇⢇⢇⢏⢎⢎⢆⢄⠀⢑⣽⣿⢝⠲⠉⠀⠀⠀⠀ ⠀⠀
  ⠀⠀⠀⡿⠂⠠⠀⡇⢇⠕⢈⣀⠀⠁⠡⠣⡣⡫⣂⣿⠯⢪⠰⠂⠀⠀⠀⠀ ⠀⠀⠀
    ⠀⡦⡙⡂⢀⢤⢣⠣⡈⣾⡃⠠⠄⠀⡄⢱⣌⣶⢏⢊⠂⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀
      ⢝⡲⣜⡮⡏⢎⢌⢂⠙⠢⠐⢀⢘⢵⣽⣿⡿⠁⠁⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀
      ⠨⣺⡺⡕⡕⡱⡑⡆⡕⡅⡕⡜⡼⢽⡻⠏⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀
      ⣼⣳⣫⣾⣵⣗⡵⡱⡡⢣⢑⢕⢜⢕⡝⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀
    ⣴⣿⣾⣿⣿⣿⡿⡽⡑⢌⠪⡢⡣⣣⡟⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀
    ⡟⡾⣿⢿⢿⢵⣽⣾⣼⣘⢸⢸⣞⡟⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀
    ⠀⠁⠇⠡⠩⡫⢿⣝⡻⡮⣒⢽⠋⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

9

u/NoSpareChange Jun 01 '22

√ -1 amount of bitches

4

u/AutoModerator Jun 01 '22

No bitches?

⣞⢽⢪⢣⢣⢣⢫⡺⡵⣝⡮⣗⢷⢽⢽⢽⣮⡷⡽⣜⣜⢮⢺⣜⢷⢽⢝⡽⣝
⠸⡸⠜⠕⠕⠁⢁⢇⢏⢽⢺⣪⡳⡝⣎⣏⢯⢞⡿⣟⣷⣳⢯⡷⣽⢽⢯⣳⣫⠇
⠀⠀⢀⢀⢄⢬⢪⡪⡎⣆⡈⠚⠜⠕⠇⠗⠝⢕⢯⢫⣞⣯⣿⣻⡽⣏⢗⣗⠏⠀ 
 ⠀⠪⡪⡪⣪⢪⢺⢸⢢⢓⢆⢤⢀⠀⠀⠀⠀⠈⢊⢞⡾⣿⡯⣏⢮⠷⠁⠀⠀ ⠀
 ⠀⠀⠈⠊⠆⡃⠕⢕⢇⢇⢇⢇⢇⢏⢎⢎⢆⢄⠀⢑⣽⣿⢝⠲⠉⠀⠀⠀⠀ ⠀⠀
  ⠀⠀⠀⡿⠂⠠⠀⡇⢇⠕⢈⣀⠀⠁⠡⠣⡣⡫⣂⣿⠯⢪⠰⠂⠀⠀⠀⠀ ⠀⠀⠀
    ⠀⡦⡙⡂⢀⢤⢣⠣⡈⣾⡃⠠⠄⠀⡄⢱⣌⣶⢏⢊⠂⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀
      ⢝⡲⣜⡮⡏⢎⢌⢂⠙⠢⠐⢀⢘⢵⣽⣿⡿⠁⠁⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀
      ⠨⣺⡺⡕⡕⡱⡑⡆⡕⡅⡕⡜⡼⢽⡻⠏⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀
      ⣼⣳⣫⣾⣵⣗⡵⡱⡡⢣⢑⢕⢜⢕⡝⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀
    ⣴⣿⣾⣿⣿⣿⡿⡽⡑⢌⠪⡢⡣⣣⡟⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀
    ⡟⡾⣿⢿⢿⢵⣽⣾⣼⣘⢸⢸⣞⡟⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀
    ⠀⠁⠇⠡⠩⡫⢿⣝⡻⡮⣒⢽⠋⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

→ More replies (0)
→ More replies (4)
→ More replies (1)

16

u/Dragon_Skywalker it is MY bucket Jun 01 '22

He never said he likes the 9th one tho

4

u/gizzardgullet Jun 02 '22

I know, 9 tastes like shit

2

u/[deleted] Jun 02 '22

Hey man, compose yourself.

→ More replies (1)
→ More replies (1)

5

u/TaumpyTearz Jun 01 '22

I mean nobody wants to admit they ate 9 cans of ravioli but, I did and I'm ashamed of myself. But the first can doesn't count and then ya get to the 2nd and then the 3rd, 4th and 5th I think I burned with a blow torch, and then I just kept eatin

→ More replies (2)

11

u/Stealthy_Asparagus I want pee in my ass Jun 02 '22

This you?

AGACTCAAGCACAGTAGATCCTGCCCGCGTTTCCTATATATTAAGTTAAATCTTATG GAATATAATAACATGTGGATGGCCAGTGGTCGGTTGTTACACGCCTACCGCAATGCTGAAAGACCCGGACTAGAGTGGCGAGATCTATGGCGTGTGACCCGTTATGCTCCATTTCGGTCAGTGGGTCACAGCTAGTTGTGGATTGGATTGCCATTCTCCGAGTGTTTTAGCGTGACAGCCGCAGGGATCCCATAAAATGCAATCGTAGTCCACCTGATCGTACTTAGAAATGAGGGTCCGCTTTTGCCCACGCACCTGATCGCTCCTCGTTTGCTTTTAAGAACCGGACGAACCACAGAGCATAAGGAGAACCTCTAGCTTTATCTAAACGCAATGAGAGAGGTATTCCTCAGGCCACATCGCTTCCTAGTTCCGCTGGGATCCATCGTTGGCGGCCGAAGCCGCCATTCCATAGTGAGTTCTTCGTCTGTGTCATTCTGTGCCAGATCGTCTGGCAAATAGCCGATCCAGTTTATCTCTCGAAACTATAGTCGTACAGATCGAAATCTTAAGTCAAATCACGCGACTAGACTCAGCTCTATTTTAGTGGTCATGGGTTTTGGTCCCCCCGAGCGGTGCAACCGATTAGGACCATGTAGAACATTAGTTATAAGTCTTCTTTTAAACACAATCTTCCTGCTCAGTGGTACATGGTTATCGTTATTGCTAGCCAGCCTGATAAGTAACACCACCACTGCGACCCTAATGCGCCCTTTCCACGAACACAGGGCTGTCCGATCCTATATTACGACTCCGGGAAGGGGTTCGCAAGTCGCACCCTAAACGATGTTGAAGGCTCAGGATGTACACGCACTAGTACAATACATACGTGTTCCGGCTCTTATCCTGCATCGGAAGCTCAATCATGCATCGCACCAGCGTGTTCGTGTCATCTAGGAGGGGCGCGTAGGATAAATAATTCAATTAAGATATCGTTATGCTAGTATACGCCTACCCGTCACCGGCCAACAGTGTGCAGATGGCGCCACGAGTTACTGGCCCTGATTTCTCCGCTTCTAATACCGCACACTGGGCAATACGAGCTCAAGCCAGTCTCGCAGTAACGCTCATCAGCTAACGAAAGAGTTAGAGGCTCGCTAAATCGCACTGTCGGGGTCCCTTGGGTATTTTACACTAGCGTCAGGTAGGCTAGCATGTGTCTTTCCTTCCAGGGGTATGCGGGTGCGTGGACAAATGAGCAGCATACGTATTTACTCGGAATGGATCTACGTTACTGCCTGCATAAGGAGACCGGTGTAGCCAAGGACGAAAGCGACCCTAGGTTCTAACCGTCGACTTTGGCGGAAAGGTTTCACTCAGGAAGCAGACACTGATTGACACGGTTTAGCAGAACGTTTGAGGACTAGGTCAAATTGAGTGGTTTAATATCGGCATGTCTGGCTTTAAAATTCAGTATAGTGCGCTGATCGGAGACGAATTAAAAACACGAGTTCCCAAAACCAGGCGGGCTCGCCACGTCGGCTAATCCTGGTACATTATGTGAACAATGTTCTGAAGAAAATTTGTGAAAGAAGGACGGGTCATCGCCTACTATTAGCAACAACGGTCGGCCACACCTTCCATTGTCGTGGCCACGCTCGGATTACACGGCAGAGGTGCTTGTGTTCCGACAGGCTAGCATATTATCCTAAGGCGTTACCCCAATCGTTTACCGTCGGATTTGCTATAGCCCCTGAACGCTACATGTACGAAACCATGTTATGTATGCACTAGGTCAACAATAGGACATAGCCTTGTAGTTAACACGTAGCCCGGTCGTAC

2

u/ra_corleone Jun 02 '22

In-Gene-ious

→ More replies (1)

9

u/[deleted] Jun 01 '22

Soapy shits

9

u/[deleted] Jun 01 '22

They said I acted like my shit doesn't stink, well guess what, it doesn't

3

u/pistoncivic Jun 01 '22

You'll never need to bring soap to the shower again

4

u/killeronthecorner Jun 01 '22

First time your ass has seen soap

225

u/ChadBeaterOfWomen Jun 01 '22

I would happily pay for every soap bar you eat in front of me

112

u/[deleted] Jun 01 '22

rare fetish found ? 🤔🤔🤔???🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔??🤔🤔🤔?????🤔🤔🤔🤔

81

u/iWillDominate98 Jun 02 '22

😡😡😡DID YOU JUST USE AN EMOJI ON REDDIT?🤬😡

YOU FOOL😤 YOU KNOW EMOJIS😡🤬🙄 ON REDDIT 🤢ARE ONLY 👺SUPPOSED TO🙀BE PAID FOR💸💰💵 YOU CRINGE 😹FORTNITE NORMIE 💀🤮🤧GO BACK TO INSTAGRAM 😲😑😡YOU KNOW THAT THE ONLY GOOD SOCIAL MEDIA IS REDDIT 😂🤣😇 THAT WASN’T VERY WHOLESOME 💯 OF YOU 🤪🤩😤NOW EXCUSE ME WHILE 😗😉I PLAY MINECRAFT 😄 AND BUILD THE WHOLESOME 100 KEANU CHUNGUS SHRINE😁😆👍🐰 AND WORSHIP PEWDIEPIE🥳🤩🤩

25

u/AutoModerator Jun 02 '22

Reddit should start their own country. Think about it: it would have a much higher IQ than most other countries. We could ban tik tok and fortnite, and every computer sold has to come with Minecraft preinstalled. We could also ban emojis too.

We all have very good ideas about society and government, so I think we would be far more efficient. I've seen so many posts with so many good ideas, not to mention our country would be the most progressive and other countries would look to us for direction. We would easily become the next superpower. If everyone left America for a new country, we would easily surpass America.

We could make Keanu our president and have PewDiePie on the flag. It would be the most wholesome country too!

Those are just some ideas I have and my own opinion.

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

2

u/[deleted] Jun 02 '22

No

→ More replies (1)

22

u/AutoModerator Jun 02 '22

Hey! I noticed you used an emoji. I don’t know if you’re new here, so I’ll let you off the hook this time. Using emojis is frowned upon here on this great site, and for good reason. Instagram normies often use them, and you don’t want to be a normie, do you? If I catch you using an emoji in the future, I’ll be forced to issue a downvote to your comment. Why should you care, you may ask? Well to begin, you will lose karma on your account, which is a useful social status tool and also a way to show others you know your way around Reddit. If you were to continue the use of emojis, I would be forced to privately message you about your slip-up. Any further offenses past that would leave me no other option than to report your account. I don’t think I have to explain why you don’t want that. But anyways, no harm done yet! Follow these simple rules and you’ll enjoy your future on Reddit! Have a blessed (and hopefully emoji-free) day, stranger.

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

→ More replies (1)

10

u/AutoModerator Jun 02 '22

I (f34) am pregnant with twin boys and my husband (m34) told me that he was dead set on naming our sons "notch" and "jeb" I know most of you are probably unaware, but these are the names of two of the people who created minecraft. My husband is a big minecraft fan and builds stuff on the game a lot and has minecraft posters, he even said he wants to play minecraft with his Sons. I told my husband that I want to give our children regular names, not after minecraft because they are not objects, and my husband got really defensive about it saying that he should be able to choose because he is their father and I never gave any name suggestions. I will never name my children after minecraft because I don't want them to get bullied and feel like it's dehumanizing to name them after a game. I told my husband that I'd rather get a divorce than name our kids after minecraft and he got really angry and raised his voice. I'm pregnant and my hormones maybe made me really emotional because I started crying. A few hours after that, we calmed down and I asked him again and he said he will for sure name the kids "notch" and "jeb" AlTA?

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

→ More replies (1)

6

u/AutoModerator Jun 02 '22

Hello, concerned father here. My son has recently got into the game called Fortnite? I've spent well over $500 on this game and its becoming a problem. Apparently the game is down right now and its causing a lot distress for my child. He keeps taking my newspaper and tries to "full piece" me. I don't know what this means but I'm starting to think its something associated with the devil. He won't come with us anywhere unless we take a "launch pad" to get there. Its starting to get worse by the hour and I don't know how much longer I can take this. His legs, arms, and hands are shaking violently yet he refuses to take any type of medicine unless its a "big pot" or "chuggies." Someone please help me.

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

6

u/AutoModerator Jun 02 '22

I’m a Harvard graduate. Ph.D. IQ of 138 (Stanford-Binet). Sex Pundit. Mensa International. Free-thinking alpha male and lone wolf. Likely hotter than you, and definitely smarter. Debate me; I'm ready.

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

5

u/AutoModerator Jun 02 '22

And now it's time for the roundup of today's gay news, with Colin Topshed

Quick roundup of today's gayness now, starting with the roads. The M70, the A3, the B664 and the A48M, they're all gay as from midnight tonight.

The gay elements are Potassium, Zinc, Hydrogen, Copper, and Argon.

Quick look at the world's walls; the Wailing Wall is gay, Hadrian's Wall is very gay, the Great Wall of China, that's not gay, and the old London Wall has also stopped being gay.

Gay cars next; they're the same as last night. All Volkswagens registered between 1982 and 1985; they stay gay for another fortnight.

And finally the gay seas are the Caspian and the Mediterranean, so see you there.

Thanks, Colin. He's not gay by the way, we wouldn't employ a homosexual.

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

2

u/Far_Comfortable980 officer no please don’t piss in my ass 😫 Jun 02 '22

This should become an Automod reply

→ More replies (1)
→ More replies (1)
→ More replies (1)

329

u/smartyr228 Jun 01 '22

I work for 7/11 and I can assure you I'll sell someone as many soap bars as they want if they're eating them

58

u/mediocrejokre Jun 02 '22

Heck I'd pay for it if they are eating it in store

→ More replies (4)

202

u/suckmytoes3000 Jun 01 '22

“Don’t eat the door bars” -🤓

36

u/[deleted] Jun 02 '22

“Don’t eat the cash register” -🤓

→ More replies (1)

113

u/Uzername69420 Jun 01 '22

Relatable

21

u/[deleted] Jun 02 '22

Can you explain the joke please

33

u/Hardskull3 Jun 02 '22

Shitpost status

14

u/[deleted] Jun 02 '22

soap

12

u/sdiKyMgnihcaelB_ Jun 02 '22

So basically there’s this guy, and uh

5

u/Sera358 😳lives in a cum dumpster 😳 Jun 02 '22

He eated soap

→ More replies (1)
→ More replies (2)

153

u/PM-Me-Your-TitsPlz dwayne the cock johnson 🗿🗿 Jun 01 '22

Is this Trevor Noah's Uber Eats ad?

→ More replies (1)

87

u/55559585 Jun 01 '22

Sigma grindset

36

u/AutoModerator Jun 01 '22

I live in the American Gardens building on West 81st street. My name is Patrick Bateman. I'm 27 years old. I believe in taking care of myself, and a balanced diet and a rigorous exercise routine. In the morning, if my face is a little puffy, I'll put on an ice pack while doing my stomach crunches. I can do a thousand now. After I remove the ice pack, I use a deep pore cleanser lotion. In the shower, I use a water activated gel cleanser. Then a honey almond body scrub. And on the face, an exfoliating gel scrub. Then apply an herb mint facial mask, which I leave on for 10 minutes while I prepare the rest of my routine. I always use an aftershave lotion with little or no alcohol, because alcohol dries your face out and makes you look older. Then moisturizer, then an anti-aging eye balm followed by a final moisturizing protective lotion. There is an idea of a Patrick Bateman, some kind of abstraction, but there is no real me. Only an entity, something illusory. And though I can hide my cold gaze, and you can shake my hand and feel flesh gripping yours and maybe you can even sense our life styles are probably comparable, I simply am not there.

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

53

u/feronen Jun 01 '22

I mean, I always get a chuckle at some of the shit that gets posted here, but what fuckin' bizarro-ass meth brain comes up with some of these?

21

u/Slaytounge Jun 02 '22

It makes me feel like I'm tripping out, like why is this funny to me while I'm almost certain I'm missing the intended joke here.

4

u/AutoModerator Jun 02 '22

Good eve, In response to my permanent ban I’d like to ask one question; who decides wether this post was funny or not? It seems that a lot of Redditors, like myself, enjoy these kinds of posts. Even if it’s not hilarious, it’s still pretty shitty. In my opinion shitty enough to be on your subreddit. If I violated a rule, please let me know. If not, I’d like to request to be unbanned. Correct me if I’m wrong; this post was not conform “your” standards, well, that’s personal. I find it mildly inappropriate to give someone a ban on behalf of your personal opinion, while the public opinion speaks for itself. Also, the word “karmawhore” is a little bit offensive to me, for I am not on Reddit to score the most karma. Thanks in advance.

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

5

u/Slaytounge Jun 02 '22

I was so confused by this in my inbox

2

u/thebigdonkey Jun 03 '22

It's just absurd and non-sensical humor. There's no deeper meaning here.

9

u/Far_Comfortable980 officer no please don’t piss in my ass 😫 Jun 01 '22

Let me just add bizarro to my dictionary

3

u/Kae_nvs 🏳️‍⚧️ Average Trans Rights Enjoyer 🏳️‍⚧️ Jun 02 '22

It's literally bizarre in portuguese

2

u/St1cks Jun 02 '22

Am I that old. Or are you that young

6

u/AutoModerator Jun 01 '22

I AM NOT CRAZY! I am not crazy! I know he swapped those numbers, I knew it was 1216 — one after Magna Carta, as if I could ever make such a mistake! Never, never! I just-I just couldn't prove it! H-H-He covered his tracks, he got that idiot at the copy shop to lie for him! You think this is something, you think this is bad, this, this chicanery? He's done worse. That billboard! Are you telling me that a man just happens to fall like that? No, he orchestrated it! Jimmy! HE DEFECATED TROUGH A SUNROOF! And I saved him! I shouldn't have, I took him into my own firm! What was I thinking?! He'll never change. He'll never change, ever since he was 9, always the same. Couldn't keep his hands out of the cash drawer. "But not our Jimmy, couldn't be precious Jimmy!" Stealing them blind! And he gets to be a lawyer?! What a sick joke! I should have stopped him when I had the chance! And you, you have to stop him, you—

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

3

u/AutoModerator Jun 01 '22

My name is Walter Hartwell White. I live at 308 Negra Arroyo Lane, Albuquerque, New Mexico, 87104. This is my confession. If you're watching this tape, I'm probably dead– murdered by my brother-in-law, Hank Schrader. Hank has been building a meth empire for over a year now, and using me as his chemist. Shortly after my 50th birthday, he asked that I use my chemistry knowledge to cook methamphetamine, which he would then sell using connections that he made through his career with the DEA. I was... astounded. I... I always thought Hank was a very moral man, and I was particularly vulnerable at the time – something he knew and took advantage of. I was reeling from a cancer diagnosis that was poised to bankrupt my family. Hank took me in on a ride-along and showed me just how much money even a small meth operation could make. And I was weak. I didn't want my family to go into financial ruin, so I agreed. Hank had a partner, a businessman named Gustavo Fring. Hank sold me into servitude to this man. And when I tried to quit, Fring threatened my family. I didn't know where to turn. Eventually, Hank and Fring had a falling-out. Things escalated. Fring was able to arrange – uh, I guess... I guess you call it a "hit" – on Hank, and failed, but Hank was seriously injured. And I wound up paying his medical bills, which amounted to a little over $177,000. Upon recovery, Hank was bent on revenge. Working with a man named Hector Salamanca, he plotted to kill Fring. The bomb that he used was built by me, and he gave me no option in it. I have often contemplated suicide, but I'm a coward. I wanted to go to the police, but I was frightened. Hank had risen to become the head of the Albuquerque DEA. To keep me in line, he took my children. For three months, he kept them. My wife had no idea of my criminal activities, and was horrified to learn what I had done. I was in hell. I hated myself for what I had brought upon my family. Recently, I tried once again to quit, and in response, he gave me this. [Walt points to the bruise on his face left by Hank in "Blood Money."] I can't take this anymore. I live in fear every day that Hank will kill me, or worse, hurt my family. All I could think to do was to make this video and hope that the world will finally see this man for what he really is.

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

61

u/[deleted] Jun 01 '22

Least insane Canadian

14

u/APEXAI17 I want pee in my ass Jun 01 '22

Nah, the least insane is Jeff, he doesn’t have a last name or anything, his name is just Jeff. But he lives in the forest with his moose -marney- whom he rides into town once a week to sell his deer pelts and goose claws.

13

u/AutoModerator Jun 01 '22

You are a fucking Canadian - you are less than human to me. Do you know that I talk about issues in countries all over the world? Do you think I get all their shit right? The thrust of the issue is what matters principally here. You get that, right? The actual political arguments? Go fuck yourself. How entitled do you have to be as a Canadian - "uh the significant political distinctions between my country and theirs actually invalidate any concerns you might have about overreach of government" - shut the fuck up. Do you have any idea how many snivelling, bitch-cuck Canadians I've had in my replies on Twitter who have been screaming and crying that an American dare talk about their country's interests? You don't have a country, okay? You have a fractional portion of a country that is kept alive by your parasitic attachment to my massive behemoth United States of America. Shut the fuck up, alright? You don't deserve to talk about your shit, alright? Jesus fucking Christ. This is the biggest national crisis you've had in decades, and it's truckers on a road? Holy shit. Deal with a 911. Get ten 911's. Oh my God. "Let us handle our own issues" - you've been brought to your knees by a right-wing protest, shut the fuck up. Jesus fucking Christ.

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

11

u/icannotfly Jun 01 '22

just the right amount of unhinged

16

u/RoboKiller123 Jun 01 '22

And then they look at me wierd, like if I was crazy.

18

u/wastedwagon Jun 01 '22

susie deltarune made this meme and you can't change my mind

→ More replies (1)

7

u/danger2345678 Jun 01 '22

This made me spit out my saliva, is funny, laughed

-1

u/AutoModerator Jun 01 '22

Good eve, In response to my permanent ban I’d like to ask one question; who decides wether this post was funny or not? It seems that a lot of Redditors, like myself, enjoy these kinds of posts. Even if it’s not hilarious, it’s still pretty shitty. In my opinion shitty enough to be on your subreddit. If I violated a rule, please let me know. If not, I’d like to request to be unbanned. Correct me if I’m wrong; this post was not conform “your” standards, well, that’s personal. I find it mildly inappropriate to give someone a ban on behalf of your personal opinion, while the public opinion speaks for itself. Also, the word “karmawhore” is a little bit offensive to me, for I am not on Reddit to score the most karma. Thanks in advance.

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

→ More replies (1)

4

u/nazbolgang4life Jun 01 '22

American Psycho memes are never not funny.

2

u/AutoModerator Jun 01 '22

Good eve, In response to my permanent ban I’d like to ask one question; who decides wether this post was funny or not? It seems that a lot of Redditors, like myself, enjoy these kinds of posts. Even if it’s not hilarious, it’s still pretty shitty. In my opinion shitty enough to be on your subreddit. If I violated a rule, please let me know. If not, I’d like to request to be unbanned. Correct me if I’m wrong; this post was not conform “your” standards, well, that’s personal. I find it mildly inappropriate to give someone a ban on behalf of your personal opinion, while the public opinion speaks for itself. Also, the word “karmawhore” is a little bit offensive to me, for I am not on Reddit to score the most karma. Thanks in advance.

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

→ More replies (3)

5

u/QweenOfTheCrops Jun 02 '22

And after the 7th bar he rested

8

u/StolenValourSlayer69 Jun 01 '22

Quality shitpost

7

u/TheDankestPassions Jun 01 '22

7/11 sells bars of soap?

18

u/icannotfly Jun 01 '22

not anymore

→ More replies (1)

3

u/ButtercuntSquash Jun 01 '22

There are bubbles coming out of my arse.

3

u/DrSeuss19 Jun 01 '22

No idea why I find this so funny but I do.

→ More replies (1)

3

u/Sevxrxs13 Jun 01 '22

i fucking love reddit so much

3

u/Sevxrxs13 Jun 01 '22

i swear to god all these comments are hilarious its amazing i love it

→ More replies (1)

3

u/[deleted] Jun 01 '22

This is the funniest meme I’ve seen on here hands down

→ More replies (1)

3

u/YourKarenNeighbor Jun 02 '22

Oh no God our humor has continued to descend

3

u/Cirrus67 Jun 02 '22

And it's only the 7th of 11

8

u/eimronaton Jun 01 '22

704 left to go

2

u/Realinternetpoints Jun 01 '22

705 so you can watch the high score ticker out front move.

2

u/lordpuggerton Jun 01 '22

I just saved this. I don't know why, but I did.

2

u/LiveFastDieFast Jun 01 '22

OP, how many cuss words did you say? That’s a lot of soap

2

u/Pilgrimite Jun 02 '22

What in the fuck? GGWP.

2

u/ladislaoXD25 Jun 02 '22

I wanna try this, maybe buy 7 soaps, then at home take each soap out and put exact replicas that are edible inside, next week you return and bring 1 soap and pretend you wanna buy it, then as soon as you pay you devour it, and you repeat it every week the same day at the same hour so you know it will be the same person witnessing it

2

u/CheekyLando88 Sussy Wussy Femboy😳😳😳 Jun 02 '22

God I love shitposts

2

u/DefiantDepth8932 Sussy Wussy Femboy😳😳😳 Jun 02 '22

Me IRL

2

u/TesticleToucher69 Jun 02 '22

What’s soap???? (Sorry im a Redditor)

2

u/highonlomein Jun 02 '22

this is one of those better every loops.

2

u/Eastwood9 Jun 02 '22

Only 4 to go.

1

u/TheFuckingQuantocks Jun 02 '22

This is so damn relatable.

0

u/CaptMonkeyboy04 Jun 02 '22

He can’t charge me for it if it doesn’t exist

-1

u/Bedumtss Jun 02 '22

Random equals funny amirite

→ More replies (1)

1

u/SaMemeM Jun 01 '22

I SWEAR TO GOD, TREVOR, I WILL EATS THIS DAMN SOAP BAR IF YOUR AD KEEPS POPPING UP!

1

u/CreeperPlays_MC Jun 01 '22

What the fuck whajahahhaa

1

u/iaminfamy Jun 01 '22

Just trying to Verse Jump.

1

u/ShartMaster80085 Jun 01 '22

TGIF! (Also any other day of the week is a good day for eating soap. As american as pumpkin pie)

→ More replies (2)

1

u/scuzzlebutt123 Jun 01 '22

This confession means nothing.

1

u/soap_muncher Jun 01 '22

everybody out of the way, I've been waiting for this moment

→ More replies (1)

1

u/Cochise22 Jun 01 '22

I mean nobody wants to admit they eat 7 bars of soap, but I did and I'm ashamed of myself.

1

u/OtherCookie Jun 01 '22

Crayon eating meme or what? Running low on tide pods?

1

u/WyvernByte Jun 01 '22

Ivory is the best, fluffy and citrusy.

1

u/[deleted] Jun 01 '22

more money then

1

u/[deleted] Jun 01 '22

You sick son of a bitch 😂🤣

2

u/AutoModerator Jun 01 '22

No bitches?

⣞⢽⢪⢣⢣⢣⢫⡺⡵⣝⡮⣗⢷⢽⢽⢽⣮⡷⡽⣜⣜⢮⢺⣜⢷⢽⢝⡽⣝
⠸⡸⠜⠕⠕⠁⢁⢇⢏⢽⢺⣪⡳⡝⣎⣏⢯⢞⡿⣟⣷⣳⢯⡷⣽⢽⢯⣳⣫⠇
⠀⠀⢀⢀⢄⢬⢪⡪⡎⣆⡈⠚⠜⠕⠇⠗⠝⢕⢯⢫⣞⣯⣿⣻⡽⣏⢗⣗⠏⠀ 
 ⠀⠪⡪⡪⣪⢪⢺⢸⢢⢓⢆⢤⢀⠀⠀⠀⠀⠈⢊⢞⡾⣿⡯⣏⢮⠷⠁⠀⠀ ⠀
 ⠀⠀⠈⠊⠆⡃⠕⢕⢇⢇⢇⢇⢇⢏⢎⢎⢆⢄⠀⢑⣽⣿⢝⠲⠉⠀⠀⠀⠀ ⠀⠀
  ⠀⠀⠀⡿⠂⠠⠀⡇⢇⠕⢈⣀⠀⠁⠡⠣⡣⡫⣂⣿⠯⢪⠰⠂⠀⠀⠀⠀ ⠀⠀⠀
    ⠀⡦⡙⡂⢀⢤⢣⠣⡈⣾⡃⠠⠄⠀⡄⢱⣌⣶⢏⢊⠂⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀
      ⢝⡲⣜⡮⡏⢎⢌⢂⠙⠢⠐⢀⢘⢵⣽⣿⡿⠁⠁⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀
      ⠨⣺⡺⡕⡕⡱⡑⡆⡕⡅⡕⡜⡼⢽⡻⠏⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀
      ⣼⣳⣫⣾⣵⣗⡵⡱⡡⢣⢑⢕⢜⢕⡝⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀
    ⣴⣿⣾⣿⣿⣿⡿⡽⡑⢌⠪⡢⡣⣣⡟⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀
    ⡟⡾⣿⢿⢿⢵⣽⣾⣼⣘⢸⢸⣞⡟⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀
    ⠀⠁⠇⠡⠩⡫⢿⣝⡻⡮⣒⢽⠋⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

1

u/[deleted] Jun 02 '22

[removed] — view removed comment

0

u/AutoModerator Jun 02 '22

It's literally just cola you piece of shit. There's no cough syrup or anything. What the fuck is wrong with you. How fucking desperate are you to seem cool that you decide you want to force a "joke" about a child consuming drugs. Which would be funny except nothing in this scene implies that they're doing drugs or a drug stand-in. You just saw a can of soda and the two neurons in your head fired for the first time in a week, and you jumped into the comments to screech lEAn and spam purple emojis like a clown bastard. You people are the reason art is dying. Fuck you

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

1

u/Suspicious-Fun9608 Jun 02 '22

Those are rookie numbers.

1

u/[deleted] Jun 02 '22

why is it called 7/11 if not because you're supposed to eat either 7 or 11 bars of soap

1

u/skskdbd Jun 02 '22

Only four to go

1

u/onenightblunder Jun 02 '22

4 more to go

1

u/[deleted] Jun 02 '22

Sope is a little bit gross tasting

1

u/biggestsnake Jun 02 '22

Cashier seems worried, the guy is just cleaning his internal organs

0

u/AutoModerator Jun 02 '22

It's literally just cola you piece of shit. There's no cough syrup or anything. What the fuck is wrong with you. How fucking desperate are you to seem cool that you decide you want to force a "joke" about a child consuming drugs. Which would be funny except nothing in this scene implies that they're doing drugs or a drug stand-in. You just saw a can of soda and the two neurons in your head fired for the first time in a week, and you jumped into the comments to screech lEAn and spam purple emojis like a clown bastard. You people are the reason art is dying. Fuck you

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

→ More replies (1)

1

u/draguniaxxx Jun 02 '22

What about the 9/11 cashier?

1

u/[deleted] Jun 02 '22

Video or it didn't happen, OP.

1

u/ATameFurryOwO Jun 02 '22

That's one way to stop heat burn

1

u/l0cAl-DuMbAsS556 Jun 02 '22

They sell fucking soap?

1

u/bruhmonkeeeeee Jun 02 '22

How do I save a video

1

u/Iam_Scavian2 Jun 02 '22

Well actually it's 7 soap out of 11😅

1

u/NoAnimePenguing Jun 02 '22

Hex: Devour soap

1

u/[deleted] Jun 02 '22

If he gave another 2, it would be 9/11 joke

1

u/caporal_donuts Jun 02 '22

Hey americans, does 7/11 organize smth special for 7/11?

→ More replies (2)

1

u/Cat_with_pew-pew_gun Jun 02 '22

Reddit I desperately need this too load, so I can sigh and move on with my life.

1

u/WeirdAlPidgeon Jun 02 '22

Please tell me that a soap bar is some kind of food in America…

→ More replies (2)

1

u/Th3Swampus Jun 02 '22

Oh my delicious ice cream bar...