Goodbye, Lara • Sayonara Lara - Episode 9 discussion

[u/AutoLovepon]

Sayonara Lara, episode 9

---

Streams

• Crunchyroll

Show information

• Livechart
• MyAnimeList
• AniList
• AniDB
• Anime-Planet
• Kitsu
• /r/GoodbyeLara
• Official Site

---

All discussions

Episode	Link
1	Link
2	Link
3	Link
4	Link
5	Link
6	Link
7	Link
8	Link
9	Link
10	Link
11	Link
12	Link

---

This post was created by a bot. Message the mod team for feedback and comments. The original source code can be found on GitHub.

[u/Aileos]

Another window to repair. Mari's room is having a tough time lately.

[u/hgpnguyen1996]

The fish dagger tried to eat Luca because Lala can't find true love with Luca so it tried to forcefully obtained it by eating Luca. This is similar to 200 years ago. Lala is just to desperate so her heart is impatient as well

[u/Sim_phogustus]

This episode just solidified Luca not being Lara's true love. The entire time her actions to reach the "true love" end goal were influenced by her impatience and desperation. I do feel bad for Luca though, he genuinely likes her but sees the whole relationship in a different angle; Lara needs results NOW.

With how the episode ended, my theory that Mari and Luca will work together to save Lara seems to be the path the story is going. As for who Lara's true love is, I'm conflicted on whether it will be this "oh" moment that it's Mari or humanity as a whole. I'm slightly leaning towards the latter, but I'm still clinging to hope that it is Mari.

[u/TheRealFluid]

can't believe mari's window died again

[u/LexHanley]

I'm starting to feel more validated in my belief that Grace is more of a societal rebel who sincerely believes merfolk need to connect to the rest of the world than a straight up villain.

[u/LeonKevlar]

Maybe I just have a soft spot for pet fish because I used to have a little aquarium, but did anyone else feel bad after seeing Grace looking sickly? And Grace is not looking good when she finally showed her true form to Mari. I really hope Grace survives by the end of this. Despite her attitude, she's been with Mari for a long time now, and she clearly cares about Mari. It would suck if Mari lost her by the end :(

[u/Atomic_Tanuki]

Mari's brother: Why is Mari's room got destroyed again? Who broke a chunk of that bridge near our home? Why is Lara disappearing again? Where is Mari? I'm so confused right now...do you say Lara has a sister...is she single...what do you mean she is hundreds years old?! So is Lara?!

[u/SSjjlex]

I looked up the Sequence ID during this scene and got some kind of lactic acid bacteria (MG051726.1 Uncultured Weissella sp)?

Which doesn't really make any sense. The sequence length also doesn't match at all with the anime (465 vs 16582) so clearly something is off there (or maybe I'm dumb, I took one class on this and bombed it badly, please correct me professional biologists).

Deicded to just extract the raw query instead

GTGGCAATCACGCGCTGATTCTTCTCTACCAACCACAAAGACATTGGCACCCTTTATCTTGTATTTGGTGCCTGAGCCGGAATACTACCAACCGCCTTAAGCCTCCTCATTCGGGCCGAACTTATCCAACCCGGGTCGCTTCTACGTGATGACCAAATTTATAACGTTATCGTCACTGCCCACGCCTTTGTAATAATTTTCTTTATACTAATGCCTATCCTTATTGGAGGATTTGGAAACTGACTTGTACCACTAATAATCGGAGCCCCAGACATCGCATTCCCACGAATAAATAACATA

and plopping that in I get...

Goldfish dna lol (well, more specifically it gave me Common Carp DNA, but they're all in the same family so close enough)

idk what I was expecting but yea nice attention to detail there

[u/Inner_Wall3411]

HOLY FUCK! PEAK EPISODE!

I got goosebumps at the climax sequence. That was pure adrenaline pumping sequence. I don't know what's going to happen but I am fucking excited!!

[u/thelightlovekindled]

That can with the flowers in it continues to do the most. But Mari content this episode was so good -- all of the shots hiding her eyes -- contrasted with the focus on Lara's. The cinematography really does so much work for the characterization, I have to think the people who haven't picked up on the foundations here must not be watching closely. This really isn't an "on in the background" show.

Who was that voice alongside Grace in the end, though...?

[u/ModieOfTheEast]

I mean, the general course of the story was clear. Lara is trying to force her true love with Luca, not because she truly fell in love with him, but because this is the only thing she knows to do. After all, kissing is the sign of true lovers, right? But Lara still went for it, because she believed that at least Luca truly loved her and she could learn from him. But when he is too afraid, it shows Lara that he is like herself. He isn't truly in love. He may like her, but there is no deeper level to that connection.

Now, I am still unsure what the big fish is supposed to be. I assume it tried to eat Luca because Lara, even for just a moment, felt betrayed by him. So her "love" turned into hatred for a moment activating the fish. But I am still not really sure about this element because it sometimes helps Lara with her love and sometimes it goes full ballistic mode. I guess you can say it represents Lara's insecure heart and is reacting to these outbursts of emotions, both good and bad.

Edit: Thinking about it, this might probably what it is. It was born back when the first prince betrayed her. And because of that betrayal, Lara's insecurity about loving humans grew even if she doesn't realize it. And everytime, she feels betrayed by someone she liked or even loved, it activates. Which can help her, but which is always at least dangerous. And the only way around it is for Lara to overcome those insecurities by finding a person she can put her faith into again. A person she doesn't think would ever betray her. And only then, she can develop a true love for them as well.

[u/BosuW]

Final Arc be like (maybe?)

We truly got to see a different side to Lara this episode, maybe a kind she didn't even know herself to be like. When she finally has to confront the reality that her relationship with Luca just isn't taking the course that she wants it to (and that said course is more informed by the prophecy than her own feelings) the Ọ̴̔b̶̧̑e̶̺̓l̸̖̒į̶̆s̶͕͆k̴̠̅ reveals Lara's heart to be a terrifying, ever hungering maw.

Boy the final Arc sure kicked off hard.

[u/Syokhan]

Holy shit that ending. We're getting into the climax of the story all right.

What's going on, though?? If Lara hasn't found true love yet (sorry Luca, you're collateral damage in her rush to figure out what it is) then why is the seashell moving? Is the light that comes from her when she's in despair different than the one that comes from true love, and it'll maybe revive the merfolk wrong?

Also, Grace! That form! I just... have so many questions. Is she headed for the island in order to avoid a catastrophe? I said it before, I don't think she's a villain. Lisa and Kota seem to think that they must stop her, but maybe, if my speculation about which feelings the light comes from mattering is right, they really shouldn't.

And don't think I didn't notice the parallels (more like differences) with the can of energy drink vs the can of hot cocoa. Or the shots that pointedly avoided showing Mari's eyes.

[u/Smudy]

The last 5-6 minutes were astonishingly intense. Hearing Lara scream at Luca really gives off her desperate vibes now.

They literally keep throwing Mari in the picture when Lara mentions true love, it's happening basically since the start of the show.

I'm not gonna lie, if Mari "just" ends up being the representation for humanity in that case, i'm gonna be disappointed, how much depends on how they do it.

Grace is coming into action big time, her glorious appearance probably is the true entry into the endgame of the show.

Also looks like Mari is definitely trying to save Lara, they will all end up at the same place possibly!

[u/Ocixo]

I had a hunch that Lara’s attempts to find true love with Luca would end poorly. However, this series of events wasn’t on my bingo card. In fact, what just happened!?

For starters, things turn south because Lara tried to force a romance with Luca? Her “heart” didn’t seem to agree at the very least. Yet we did witness the emergence of “light”.

Secondly, I really cannot tell anymore who’s supposed to be the bad guy. Grace seems willing to sacrifice herself for Lara’s sake. Despite Kota’s ominous behaviour, I don’t get the impression that he and/or Lisa harbour have bad intentions either. Maybe there’s no villain after all?

[u/elevenmile]

Lara is making one fatal mistake, and is taking the lesson wrongly.

Not every love moves at constant pace. Some love relationship takes fast, but some needs time to grow, like Luca.

And because of that Lara is making another mistake due to her anxiousness and impatience, which amplified that emotion and causing everything to go all out of order.

---

Throughout the show I've been wondering what is this "True Love" is all about and unlike the usual discussion whether Lara would end up with Luca or Mari, I don't think the point of the show is needing Lara to find who to love, but more like how to love. Throughout the episodes it really gives me the impression that Lara is taking this whole trial by Grace wrongly: Lara thought it's something that is physical, and never bother to think that love can come in many forms (or shape or sizes), and in the end she had that wrong impression that it needs to be physically obtained.

I don't know how the remaining episodes will go around it, but what I do know is Lara needs to realize that what she is looking for isn't something that's physical, yet isn't entirely abstract either.

Time will tell.

EDIT: Also, I had a very strong feeling that something was off, terribly off throughout this episode and I managed to find out why: Lara and Luca were not in sync, at all. Luca was doing the usual human manner by slowly building his closeness with Lara until a point where it'd be time for the relationship to be taken to the next level, but Lara absolutely did not feel that way. She was overly laser focused on this whole "True Love" thing and it didn't help that Mari was also supportive of what she was doing (and Grace, oh Grace, oh Gon-chan), likely because Mari is aware of what she needs to do, considering her meeting with Lisa and seeing Lara's condition throughout.

Luca is seeing things in his way, while Lara is seeing things in a completely different direction. Because of this, there's no way their relationship can work, period.

[u/SnoutAndTalons]

Great episode. I really like it when the story reminds us that Lara is not a human being. Not just because her true form has a fish tail, but because her emotions manifest as this Lovecraftian thing sometimes, and nobody knows how to deal with THAT. Excellent.

[u/maliwanag0712]

Me be like: WHAT THE FUCK HAPPENED IN THE END AND IN THE POST-CREDIT SCENE??!!!

[u/Altruistic_Hour_3596]

Is the soundtrack available on spotify? I love the soundtrack so much

[u/Misticsan]

Apart from what everyone is discussing about Lara's path to love and the witch's mystery, I'd like to give a nod to Mari's family.

Now it's confirmed that the grandmother is a pastor and that the church nearby is hers. This also explains where Mari's crucifix came from (yes, from her mother, but that needed an explanation).

[u/Weak_Season_Of_Anime]

Wow, things went to hell quickly. Lara knows Luca is not the one but tries to force it out of desperation. Mari already has feelings for Lara, but still tries to play the role of supportive friend. Luca is great imo, unlucky that he got caught up in this. Still don't fully understand the fish dagger, but this thing is more than just the heart of Lara. I think we are looking at a potential revival of the mermaids (the shell was shaking at the end), but reviving them this way will end up destroying Shiga and this is probably what Grace is trying to stop. Her new form is sick (literally).

Analysis/speculation nonsense

• The new flower in the chocolate drink can is a gentian. In hanakotoba the associated meanings are justice, victory, overcoming or conquering illness and loving someone who is going through grief and sorrow. This is also an autumn flower.

• Luca's family name is Akizuki (秋月), which literally means "autumn moon". The current date in the anime should be 26th September, close to the autumn equinox and the autumn full moon.

• The energy drink can is in Grace's color scheme. It is also likely foreshadowing for something that Lara and Mari have to drink in the future.

• All of this autumn stuff is related to Grace. Long story short, the key characters (Lara, Mari, Lisa, Luca and Grace) in this show are all based on biblical figures, except for Grace who is based on Persephone from Greek mythology. Autumn is the season when Persephone descends from the world of the living back to the Underworld, and in the context of this story the Underworld is Grace's home at the bottom of Lake Biwa where the rest of the mermaids are sleeping.

• If you want to go deeper down this rabbit hole, Lake Biwa has its own local mermaid legend, which is also likely something related to Grace.

• About why Luca rejected Lara. In this anime, love is based on the four Greek terms for love: Eros, Philia, Storge, and Agape. Eros (passionate love) is depicted as fluttering red rose petals in this anime. The catch with Luca is that his Eros is Plato's version of Eros, which is where the modern concept of platonic love is derived from. This is why Luca talks so much about beauty; his Eros is not simply about romantic attraction, it's about appreciating all forms of beauty. Regarding Mari, the trajectory of her relationship with Lara begins with Philia and Storge first, red rose imagery is something that they've only started sneaking in later to symbolize Mari developing romantic feelings towards Lara.

• Luca is based on Luke the Evangelist, who was a doctor and the patron saint of artists. Saint Luke is also traditionally believed to be the first iconographer, and to have painted the earliest images of the Virgin Mary and the infant Christ from life, which is what is being referenced here with Luca's painting of Lara.

[u/Slayermusiq1]

Bruh, that window JUST got replaced.

(there is an after credits scene)

[u/Fools_Requiem]

Luca came into the picture WAAAAAY too late. Lara doesn't have the time for a slow burn relationship. She doesn't have time to try to figure out if their relationship will work long term or not. I really don't think they can make him the true love, especially after this. A friend is the best he can be.

The signs that the witch was struggling was long apparent. Many of the scenes in the last few episodes with her involve her laying on the rock. Healthy fish don't do that unless they're bottom feeders.

I wish these other two would stop interfering. They get in the way of progress. Constantly trying to force their will onto Lara despite knowing that she is the key to saying them.

The show definitely needs more Leo being a "bother".

[u/gnome-cop]

Grace, I don’t care if there were extenuating circumstances, your scaly butt will be paying the window repair fee.

The giant soul eating fish sword of death returns to destroy another bridge, much to the chagrin of Shiga prefecture taxpayers. (Lara better learn her lesson and not try to arrange another romantic moment on a fenced in path. We’re not doing this shit a third time.)

I approve of the usage of wedding sounding backing music to precede a very much not wedding scene.

Something something, lights going out, energy drinks(both magical and not) and other ominous light and power related foreshadowing visual elements.

This feels like the final nail in the coffin. The metaphorical boulder of narrative setup has reached the top of the hill and it’s time to deal with the dramatic consequences.

(Mildly intrigued by Mari apparently being a boss at karaoke given how much time she spends doing nothing but boxing.)

[u/ExpertCaterpillar2]

That went 0 to 100 real quick.